rabbit polyclonal antibody against c iap1 Search Results


90
Merck KGaA rabbit polyclonal igg antibodies against c-iap1 and xiap
Diagrams of ( a ) the gene promoters <t>of</t> <t>c-IAP1</t> and ( b ) <t>XIAP</t> and heat maps of the log 2 (fold change) mRNA levels of the GR and the IAP gene family. The gene promoters of a) c-IAP1 , ( b ) XIAP and glucocorticoid receptor ( N3RC1 ) response elements (GRE) are shown as white squares ( GRE sequence: AGAACANNNTGTTCT) . NF-κB response elements ( ΚBRE sequence: AGTTGAGGGGACTTTCCCAGG ) of the p65 subunit are shown as black squares. The diagrams were modified from those available in the eukaryotic promoter database [ , ] . c Glucocorticoid receptor. d The eight members of the mammalian IAP family. The data were normalized to ethanol (ETOH)-treated cells. The data represent the fold increase over the control (ETOH ± standard deviation [SD]); n = three independent experiments
Rabbit Polyclonal Igg Antibodies Against C Iap1 And Xiap, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/rabbit+polyclonal+antibody+against+c+iap1/pmc06466787-53-7-12?v=Merck+KGaA
Average 90 stars, based on 1 article reviews
rabbit polyclonal igg antibodies against c-iap1 and xiap - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Diagrams of ( a ) the gene promoters of c-IAP1 and ( b ) XIAP and heat maps of the log 2 (fold change) mRNA levels of the GR and the IAP gene family. The gene promoters of a) c-IAP1 , ( b ) XIAP and glucocorticoid receptor ( N3RC1 ) response elements (GRE) are shown as white squares ( GRE sequence: AGAACANNNTGTTCT) . NF-κB response elements ( ΚBRE sequence: AGTTGAGGGGACTTTCCCAGG ) of the p65 subunit are shown as black squares. The diagrams were modified from those available in the eukaryotic promoter database [ , ] . c Glucocorticoid receptor. d The eight members of the mammalian IAP family. The data were normalized to ethanol (ETOH)-treated cells. The data represent the fold increase over the control (ETOH ± standard deviation [SD]); n = three independent experiments

Journal: BMC Cancer

Article Title: Glucocorticoid-dependent expression of IAP participates in the protection against TNF-mediated cytotoxicity in MCF7 cells

doi: 10.1186/s12885-019-5563-y

Figure Lengend Snippet: Diagrams of ( a ) the gene promoters of c-IAP1 and ( b ) XIAP and heat maps of the log 2 (fold change) mRNA levels of the GR and the IAP gene family. The gene promoters of a) c-IAP1 , ( b ) XIAP and glucocorticoid receptor ( N3RC1 ) response elements (GRE) are shown as white squares ( GRE sequence: AGAACANNNTGTTCT) . NF-κB response elements ( ΚBRE sequence: AGTTGAGGGGACTTTCCCAGG ) of the p65 subunit are shown as black squares. The diagrams were modified from those available in the eukaryotic promoter database [ , ] . c Glucocorticoid receptor. d The eight members of the mammalian IAP family. The data were normalized to ethanol (ETOH)-treated cells. The data represent the fold increase over the control (ETOH ± standard deviation [SD]); n = three independent experiments

Article Snippet: Rabbit polyclonal IgG antibodies against c-IAP1 and XIAP were obtained from Upstate (Merck, Darmstadt, Germany).

Techniques: Sequencing, Modification, Control, Standard Deviation

Cortisol and dexamethasone mediate sustained protein levels of c-IAP1 and XIAP during protection from TNF. Western blot immunoassay detecting c-IAP1 a or XIAP c using 30 μg of total proteins from MCF7 cells a and c treated with ethanol (ETOH), cortisol (CORT), or CORT + TNF for different lengths of time (3, 6, 12, 18, 24, 36, and 48 h). Lane 1 corresponds to cells treated with only vehicle (ETOH) for the indicated time b and d . Histograms representing panel a and panel c with the ratios of normalized c-IAP1 (panel a ) and XIAP (panel c ) levels to the β-actin signal (relative density [RD]) in cells treated with CORT. Vertical lines indicate the standard deviation (SD) of the mean (* p < 0.005). Data are presented as the mean ± SD; n = 3. Panels e and g are the same as a and c but with DEX instead of CORT. Panels f and g are the same as b and d , but with DEX instead of CORT. (* p < 0.005). Data are presented as the mean ± SD; n = 3

Journal: BMC Cancer

Article Title: Glucocorticoid-dependent expression of IAP participates in the protection against TNF-mediated cytotoxicity in MCF7 cells

doi: 10.1186/s12885-019-5563-y

Figure Lengend Snippet: Cortisol and dexamethasone mediate sustained protein levels of c-IAP1 and XIAP during protection from TNF. Western blot immunoassay detecting c-IAP1 a or XIAP c using 30 μg of total proteins from MCF7 cells a and c treated with ethanol (ETOH), cortisol (CORT), or CORT + TNF for different lengths of time (3, 6, 12, 18, 24, 36, and 48 h). Lane 1 corresponds to cells treated with only vehicle (ETOH) for the indicated time b and d . Histograms representing panel a and panel c with the ratios of normalized c-IAP1 (panel a ) and XIAP (panel c ) levels to the β-actin signal (relative density [RD]) in cells treated with CORT. Vertical lines indicate the standard deviation (SD) of the mean (* p < 0.005). Data are presented as the mean ± SD; n = 3. Panels e and g are the same as a and c but with DEX instead of CORT. Panels f and g are the same as b and d , but with DEX instead of CORT. (* p < 0.005). Data are presented as the mean ± SD; n = 3

Article Snippet: Rabbit polyclonal IgG antibodies against c-IAP1 and XIAP were obtained from Upstate (Merck, Darmstadt, Germany).

Techniques: Western Blot, Standard Deviation

Pearson correlation coefficient of the coexpression of NR3C1 vs IAP family genes

Journal: BMC Cancer

Article Title: Glucocorticoid-dependent expression of IAP participates in the protection against TNF-mediated cytotoxicity in MCF7 cells

doi: 10.1186/s12885-019-5563-y

Figure Lengend Snippet: Pearson correlation coefficient of the coexpression of NR3C1 vs IAP family genes

Article Snippet: Rabbit polyclonal IgG antibodies against c-IAP1 and XIAP were obtained from Upstate (Merck, Darmstadt, Germany).

Techniques:

GC-mediated protection against TNF is diminished by inhibiting c-IAP1 or XIAP expression. Western blot immunoassay of MCF7 cells transfected with the four siRNAs against c-IAP1 ( a ) or XIAP ( b ) for 18 h. MOCK: no siRNA; NR-siRNA: nonrelated siRNA; c-IAP1-siRNA and XIAP-siRNA, from 1 through 4 (with four different sequences each). The histograms present the ratios of normalized siRNA-targeted c-IAP1 and XIAP expression to normalized β-actin expression. For transfections, we used the lowest IAP/β-actin ratio. Vertical lines indicate the standard deviation of the mean (* p < 0.005). Data are presented as the mean ± standard deviation [SD]; n = 3. c ) Viability assay of MCF7 cells treated for 24 h with the indicated treatments. An average of two independent experiments was performed with each sample conducted in sextuplicate. Vertical lines represent the standard deviation of the mean; * p < 0.05. Letters indicate distinct groups based on the post hoc statistical comparison ( p < 0.05). If groups share at least one letter, they do not statistically differ. Data are presented as the mean ± SD; n = 2

Journal: BMC Cancer

Article Title: Glucocorticoid-dependent expression of IAP participates in the protection against TNF-mediated cytotoxicity in MCF7 cells

doi: 10.1186/s12885-019-5563-y

Figure Lengend Snippet: GC-mediated protection against TNF is diminished by inhibiting c-IAP1 or XIAP expression. Western blot immunoassay of MCF7 cells transfected with the four siRNAs against c-IAP1 ( a ) or XIAP ( b ) for 18 h. MOCK: no siRNA; NR-siRNA: nonrelated siRNA; c-IAP1-siRNA and XIAP-siRNA, from 1 through 4 (with four different sequences each). The histograms present the ratios of normalized siRNA-targeted c-IAP1 and XIAP expression to normalized β-actin expression. For transfections, we used the lowest IAP/β-actin ratio. Vertical lines indicate the standard deviation of the mean (* p < 0.005). Data are presented as the mean ± standard deviation [SD]; n = 3. c ) Viability assay of MCF7 cells treated for 24 h with the indicated treatments. An average of two independent experiments was performed with each sample conducted in sextuplicate. Vertical lines represent the standard deviation of the mean; * p < 0.05. Letters indicate distinct groups based on the post hoc statistical comparison ( p < 0.05). If groups share at least one letter, they do not statistically differ. Data are presented as the mean ± SD; n = 2

Article Snippet: Rabbit polyclonal IgG antibodies against c-IAP1 and XIAP were obtained from Upstate (Merck, Darmstadt, Germany).

Techniques: Expressing, Western Blot, Transfection, Standard Deviation, Viability Assay, Comparison

Mechanistic map of the effect of TNF and GCs on MCF7 cells. Glucocorticoid receptor (GR), mifepristone (RU486), poly-adenyl ribosyl polymerase-1 (PARP1), nuclear factor-kappa light chain in B cells (NF-κB), cellular 1 inhibitor apoptosis protein (c-IAP1), X chromosome-linked inhibitor apoptosis protein (XIAP), and tumor necrosis factor (TNF)

Journal: BMC Cancer

Article Title: Glucocorticoid-dependent expression of IAP participates in the protection against TNF-mediated cytotoxicity in MCF7 cells

doi: 10.1186/s12885-019-5563-y

Figure Lengend Snippet: Mechanistic map of the effect of TNF and GCs on MCF7 cells. Glucocorticoid receptor (GR), mifepristone (RU486), poly-adenyl ribosyl polymerase-1 (PARP1), nuclear factor-kappa light chain in B cells (NF-κB), cellular 1 inhibitor apoptosis protein (c-IAP1), X chromosome-linked inhibitor apoptosis protein (XIAP), and tumor necrosis factor (TNF)

Article Snippet: Rabbit polyclonal IgG antibodies against c-IAP1 and XIAP were obtained from Upstate (Merck, Darmstadt, Germany).

Techniques: